cspD [2018-05-24 14:39:54]

cold shock protein

locus: BSU21930

pI: 4.31

mw: 7.17 kDa

protein length: 66 aa

gene length: 198 bp

function: RNA chaperone

product: cold shock protein

essential: no

synonyms

Genomic Context

categories

• [category|SW 3|Information processing] → [category|SW 3.2|RNA synthesis and degradation] → [category|SW 3.2.2|RNA chaperones]
• [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.5|Cold stress proteins]

Gene

Coordinates: 2,307,905 → 2,308,105

The protein

Paralogous protein(s)

• [protein|16E048FE5AF76CC771DEBBA8CB56B75A5414B3A2|CspB], [protein|D453E1E7D4256B56AFB2149731E08B104D59431B|CspC]

Structure

• [PDB|1C9O] (from ''B. caldolyticus'', 86% identity) [Pubmed|10736231]

Additional information

• subject to Clp-dependent proteolysis upon glucose starvation [Pubmed|17981983]
• belongs to the 100 [SW|most abundant proteins] [PubMed|15378759]

Expression and Regulation

Operons

• genes: [gene|0F89D0B03F54B283CDD99A940D43C18E6B5703BB|cspD]
  description: [pubmed|22383849]

Biological materials

Mutant

• GP2614 ([gene|0F89D0B03F54B283CDD99A940D43C18E6B5703BB|cspD]::''aphA3''), available in [SW|Jörg Stülke]'s lab
• MGNA-A874 (cspD::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/874 NBRP B. subtilis, Japan]
• BKE21930 (Δ[gene|0F89D0B03F54B283CDD99A940D43C18E6B5703BB|cspD]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE21930 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATTGCTTAATTCCTCCT, downstream forward: _UP4_TAAACTCAATACATGATGAT
• BKK21930 (Δ[gene|0F89D0B03F54B283CDD99A940D43C18E6B5703BB|cspD]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK21930 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATTGCTTAATTCCTCCT, downstream forward: _UP4_TAAACTCAATACATGATGAT

Expression vector

• pGP2164: expression of ''darA''-Strep by [SW|pGP382] in ''B. subtilis'' suitable for [SW|SPINE], available in [SW|Jörg Stülke]'s lab
• pGP2165: expression of ''darA''-Strep by [SW|pGP380] in ''B. subtilis'' suitable for [SW|SPINE], available in [SW|Jörg Stülke]'s lab

two-hybrid system

• B. pertussis adenylate cyclase-based bacterial two hybrid system (BACTH), available in [SW|Stülke] lab

References

Reviews

• 12171653,12838604

Original publications

• 12399512,11752341,11717297,9920884,12427936,11591689,9379903,17981983,15378759,10736231